View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048_low_54 (Length: 226)
Name: NF3048_low_54
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 26 - 211
Target Start/End: Complemental strand, 45147698 - 45147518
Alignment:
| Q |
26 |
cacttctctcattccttcttattctctctatttctaatcatctaccacaaatgtgcgactatgattgggtcaacttagccatggctaacgattccatcgt |
125 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45147698 |
cacttctctcattccttcttattctct--atttctaatc---taccacaaatgtgcgactatgattgggtcaacttagccatggctaacgattccatcgt |
45147604 |
T |
|
| Q |
126 |
agccaaccttctcctccacttcaacaacccaccaccacctccctcacttcaactccactggaccatccgtcaaccccgctccaggt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45147603 |
agccaaccttctcctccacttcaacaacccaccaccacctccctcacttcaactccactggaccatccgtcaaccccgctccaggt |
45147518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University