View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048_low_56 (Length: 219)
Name: NF3048_low_56
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 4710448 - 4710652
Alignment:
| Q |
1 |
tattttataatatattgttaggttacttaggtatgattaggtttcctttat---aaaagcacagtaaacaccatcttattaatggtttcagaggctgata |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4710448 |
tattttataatatattgttaggttacttaggtatgattaggtttcctttattataaaagcacagtaaacaccatcttattaatggtttcagaggctgata |
4710547 |
T |
 |
| Q |
98 |
acacttcggaaaacaggtttagtggaaagaaatcattctttaaattattaaataagtattttaactacttttttccaaaaggattattgattttcatgcc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4710548 |
acacttcggaaaacaggtttagtggaaagaaatcattctttaa---attaaataagtattttaactacttttttccaaaaggattattgattttcatgcc |
4710644 |
T |
 |
| Q |
198 |
atgaatat |
205 |
Q |
| |
|
|||||||| |
|
|
| T |
4710645 |
atgaatat |
4710652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University