View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3048_low_58 (Length: 212)

Name: NF3048_low_58
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3048_low_58
NF3048_low_58
[»] chr5 (1 HSPs)
chr5 (18-196)||(10870865-10871043)
[»] chr6 (1 HSPs)
chr6 (33-70)||(14944291-14944328)


Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 10871043 - 10870865
Alignment:
18 ttaattgggatcaaaattttttattatgacttattatgcaagtaacattgattgttttcttttgattagaggagactcaattcaatttcgttttttgtga 117  Q
    ||||||||||||||||   |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |||    
10871043 ttaattgggatcaaaaaaatttattatgacttattatgcaagtaacattgattgtttccttttgattagaggagactcaattcgatttcgttttttatga 10870944  T
118 ttttctgaaaattttaatctatcagtttgtttctactttatctgtataattcataacttgtgctgtctttgaggatttt 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10870943 ttttctgaaaattttaatctatcagtttgtttctactttatctgtataattcataacttgtgctgtctttgaggatttt 10870865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 33 - 70
Target Start/End: Original strand, 14944291 - 14944328
Alignment:
33 attttttattatgacttattatgcaagtaacattgatt 70  Q
    |||||||||||||||||||||||||||||||| |||||    
14944291 attttttattatgacttattatgcaagtaacactgatt 14944328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University