View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3049_high_31 (Length: 228)
Name: NF3049_high_31
Description: NF3049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3049_high_31 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 113 - 228
Target Start/End: Original strand, 1539408 - 1539523
Alignment:
| Q |
113 |
agtggtggtgtgctgacaggccaatatactaacattatcttttccacgtaattggtttgacggtctgtctgtgaagcacatgatagtgtagtgattattc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
1539408 |
agtggtggtgtgctgacaggccaatatactaacattatcttttccctgtaattggtttgacggtccgtctgtgaagcacatgacagtgtagtgattattc |
1539507 |
T |
 |
| Q |
213 |
ttaagtagtgttttta |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1539508 |
ttaagtagtgttttta |
1539523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 21 - 70
Target Start/End: Original strand, 1539314 - 1539363
Alignment:
| Q |
21 |
accagagaagtaacaatacaatgcaagaatacgtgtcgaaagtggtggca |
70 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
1539314 |
accagagaagtaacaatacaacgcaggaatacgtgtcgaaagtggtggca |
1539363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University