View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3049_low_13 (Length: 385)
Name: NF3049_low_13
Description: NF3049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3049_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 20 - 375
Target Start/End: Complemental strand, 8453026 - 8452677
Alignment:
| Q |
20 |
gcatgattatgtgaaaattcacacatccttttcctctataaagtaatattatctgctcttcattcttcttgtaatgtcttaaatattatggatttatcag |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8453026 |
gcatgattatgtgaaaattgacacatccttttcctctataaagtaatattatctgctcttcattcttcttgtaatgtcttaaatat---ggatttatcag |
8452930 |
T |
 |
| Q |
120 |
actttaccaactgttgccttttctcttatcatgctcctcagtatccaatatccatccatccttggcctttgattaattatttaacttgaacttgatcttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8452929 |
actttaccaactgttgccttttctcttatcatgctcctcagtatccaatatccatccatccttggcctttgattaattatttaacttgaacttgatcttg |
8452830 |
T |
 |
| Q |
220 |
gtgcaagccggttacaagttcaagatagggataaaggtttgaatttttattacatttaatttgatgatcattatgctgtatttcctattgttccttagtt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8452829 |
gtgcaagccggttacaagttcaagatagggataaaggtttgaatttttattacatttaatttgatgatcattatgttgtatttcctattgttccttagtt |
8452730 |
T |
 |
| Q |
320 |
taca-ttttnnnnnnntgataatttaattaatatccccctcttcatccttgcctatg |
375 |
Q |
| |
|
|||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8452729 |
tacatttttccccccctgataat----ttaatatccccctcttcatccttgcctatg |
8452677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University