View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3049_low_21 (Length: 285)
Name: NF3049_low_21
Description: NF3049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3049_low_21 |
 | |
|
| [»] scaffold0121 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0121 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 10 - 186
Target Start/End: Complemental strand, 28663 - 28488
Alignment:
| Q |
10 |
tcatcacaaattaaaatgcctcggtctctatgacctcacttgtgccaaacgtgcacataaaatatctaatgtggaccaccgaccaaaccactatgaaaag |
109 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28663 |
tcatcataaatcaaaatgcctcggtctctatgacctcacttgtgccaaacgtgcacataaaatatctaatgtggaccaccgaccaa-ccactatgaaaag |
28565 |
T |
|
| Q |
110 |
tgaaatgaatgaaacaatataaaagtgaaacacattatcatcaactagatttgatatcctaacttaacaaccctata |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
28564 |
tgaaatgaatgaaacaatataaaagtgaaacacattatcatcaactagatttgatatcccagcttaacaaccctata |
28488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University