View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3049_low_30 (Length: 237)
Name: NF3049_low_30
Description: NF3049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3049_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 45868221 - 45868004
Alignment:
| Q |
1 |
cctgtgtgagatgttgggatctttgagtagcttcggcattgagcttggtggatgcttccctgaaacaacgagatttaatttaaatttaatcaatttggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45868221 |
cctgtgtgagatgttgggatctttgagtagcttcagcattgagcttggtggatgcttccctgaaacaacgagatttaatttaaatttaatcaatttggta |
45868122 |
T |
|
| Q |
101 |
taacagcaattaaaatttgaaagaagaagaagaagcgaaaggggttactggaagtagaaatcgaaagtatcgaggacgaaatcatcaacagtgttgagaa |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45868121 |
taacaacaattaaaatttgaaagaagaagaagaagcgaaaggggttactggaagtagaaatcgaaagtatcgaggacgaaatcatcaacagtgttgagaa |
45868022 |
T |
|
| Q |
201 |
cttcgttgaagaagagtt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45868021 |
cttcgttgaagaagagtt |
45868004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 45982784 - 45982850
Alignment:
| Q |
1 |
cctgtgtgagatgttgggatctttgagtagcttcggcattgagcttggtggatgcttccctgaaaca |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45982784 |
cctgtgtgagatgttgggatctttgagtagcttcagcattgagcttggtggatgcttccctgaaaca |
45982850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 144 - 218
Target Start/End: Original strand, 45982929 - 45983003
Alignment:
| Q |
144 |
gttactggaagtagaaatcgaaagtatcgaggacgaaatcatcaacagtgttgagaacttcgttgaagaagagtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
45982929 |
gttactggaagtagaaatcgaaagtatcgatgaagaaatcgtcaacggtgttgagaacttcgttgaagaagagtt |
45983003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 9 - 69
Target Start/End: Complemental strand, 40892899 - 40892839
Alignment:
| Q |
9 |
agatgttgggatctttgagtagcttcggcattgagcttggtggatgcttccctgaaacaac |
69 |
Q |
| |
|
||||||||||||||||| |||| ||| |||||| ||||||||| ||||||||||||||||| |
|
|
| T |
40892899 |
agatgttgggatctttgggtaggttcagcattgggcttggtgggtgcttccctgaaacaac |
40892839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University