View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3049_low_31 (Length: 237)
Name: NF3049_low_31
Description: NF3049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3049_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 32229902 - 32230125
Alignment:
| Q |
1 |
aactcatgttactctactattaccttgactttcgatatgatannnnnnnnagttgatagcctannnnnnnggttgatggctgttggtttttatatatggt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32229902 |
aactcatgttcctctactattaccttgactttcgatatgatattttttt-agttgatagcctatttttttggttgatggctgttggtttttatatatggt |
32230000 |
T |
|
| Q |
101 |
ttaattcatctttttaaaaccgg-tggaaggtgtggatcgggatttcgtgctgtaataaagtatacggtttttacgctgtacaagatccgaccattaatt |
199 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||||| |
|
|
| T |
32230001 |
ttaatttatctttttaaaaccggctgaaaggtgtggatcgggatttcgtgctgtaataaagtacacagtttttacgctgtacaagatctgaccattaatt |
32230100 |
T |
|
| Q |
200 |
aaggatagaacgg-acagattaatg |
223 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
32230101 |
aaggatagaacggtacagattaatg |
32230125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University