View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3049_low_6 (Length: 473)
Name: NF3049_low_6
Description: NF3049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3049_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 12 - 300
Target Start/End: Original strand, 2156937 - 2157224
Alignment:
| Q |
12 |
atgagatgaaagggcttcttataattttttgcgtgacgtcttccttacaaccaacttccctcaaagaataactcacataggcgtgcgtggcattcttcaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2156937 |
atgagatgaaagggcttcttataattttttgcgtgacgtcttcattagaaccaacttccctcaaa--ataactcacataggcgtgcgtggcattcttcaa |
2157034 |
T |
|
| Q |
112 |
cataatttt-ttgtgtcagtgtttgtagtttggaggaatcggtggaagatctgtttttatcttctcattttggttctatttggcaacttcttcaatgatg |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2157035 |
cataatttttttgtgtcagtgtttgtagtttggaggaatcggtggaagatctgtttttatcttctcattttggttctatttggcaacttcttcaatgatg |
2157134 |
T |
|
| Q |
211 |
gattggtacatcggcggttgatcctctctgcttatctgatcattttatgcaacattgtaaaatgggtgggaactcaacaagtctccggtt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2157135 |
gattggtacatcggcggttgatcctctctacttatctgatcattttatgcaacatggtaaaatgggtgggaactcaacaagtctccggtt |
2157224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 354 - 454
Target Start/End: Original strand, 2157434 - 2157528
Alignment:
| Q |
354 |
tttgttta-ctggctatgatgcctaagtaactgtctgtgaactctatctactttctgttctgatacaccttatgttagacaaaaagtaatttataataaa |
452 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
2157434 |
tttgtttatctggctatgatgcctaagtaaccgtctgtgaactctatctactttctgttctgataca-------ttagacagaaagtaatttataataaa |
2157526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 299 - 360
Target Start/End: Original strand, 2157316 - 2157377
Alignment:
| Q |
299 |
tttggatgaaattaagcttctctccttttggtggccagaggcaaaacatgttaattttgttt |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2157316 |
tttggatgaaattaagcttctctccttttggtggccagagacaaaacatgttaattttgttt |
2157377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University