View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3050_high_10 (Length: 301)
Name: NF3050_high_10
Description: NF3050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3050_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 32 - 271
Target Start/End: Complemental strand, 1030051 - 1029812
Alignment:
| Q |
32 |
gaaaccgaaaccaaagtcagctatgtcacgaatccatgacaattaatcctccacatcctatcccagtcattacgaataataacctagagatttaaaagaa |
131 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
1030051 |
gaaaccgaaaccaaaatcagctatgtcacgaatccatgacaattaatcctccacgtcctatcccagtcattacgaattataacctagagattcaaaagaa |
1029952 |
T |
|
| Q |
132 |
tccctcct---tatccaagttcttgaaattttcgagtgattctttgaagggtgggatcttctggatctgcatagattatattgagagattcaacaaagag |
228 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1029951 |
cccctcctccttatccaagttctggaaattttcgagtgattctttgaagggtgggatcttctggatctgcatagattatattgagagattcaacaaagag |
1029852 |
T |
|
| Q |
229 |
gtcgtacaagtgaaggacgacgccgatgacaagatgaagacaa |
271 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
1029851 |
gtcgtacgagtgaag---gacgccgatgacaagatgaagacaa |
1029812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 1030105 - 1030071
Alignment:
| Q |
1 |
tagacgtttgctcacaaattgctacctgcatgaaa |
35 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
1030105 |
tagacgtttgctcacaaattgctacccgcatgaaa |
1030071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University