View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3050_low_14 (Length: 296)
Name: NF3050_low_14
Description: NF3050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3050_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 6856749 - 6857028
Alignment:
| Q |
1 |
taaattgattacgtagaaattataccagataaaacagaactaaaacaaattaaaatgattgatgtttgtcctcgtaacgaatgttgattcattcgtgatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6856749 |
taaattgattacgtagaaattataccagataaaacagaactaaaaaaaattaaaatgattgatgtttgtcctcataacgaatgttgattcattcgtgatt |
6856848 |
T |
 |
| Q |
101 |
tagacagcactcatcacgaatgttgactcggcttgtaagaagttgattcattcgaaaggtatagattcaactttttatcaatgtgaagacttggttgatg |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6856849 |
tagaccgcactcatcacgaatgttgactctgctt---ataagttgattcattccaaaggtatagattcaactttttatcaatgtgaagacttggttgatg |
6856945 |
T |
 |
| Q |
201 |
tacaaatttataag-nnnnnnncaagtttcactaattgttgttgtcaactttgacttcggtaagaaaattgttcttctccctct |
283 |
Q |
| |
|
|| |||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
6856946 |
ta-taatttataagtttctttgcaagtttcactaattgttgatgtcaactttgacttccgtaagaaaattgttcttttccctct |
6857028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University