View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3050_low_16 (Length: 281)
Name: NF3050_low_16
Description: NF3050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3050_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 41897243 - 41896978
Alignment:
| Q |
1 |
atgtaagaaaattatgaaactaccactgaagtccgtcttgggggacaaatatctggtgatatgaatattatcacttggtggcttctgacagtggtagtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41897243 |
atgtaagaaaattatgaaactaccactgaagtacgtcttgggggacaaatatctggtgatatgaatattatcacttggtggcttctgacagtggtagtaa |
41897144 |
T |
 |
| Q |
101 |
gtattgatggaaatcctctttcacttgttgtagtagcagcagcaaaccgtgcaccatga-ttttggtactagctagtagctagaaccccaagaacaatag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41897143 |
gtattgatggaaatcctctttcacttgttgtagtagtagcagcaatccgtgcaccatgatttttggtactagctagtagctagaaccccaagaacaatag |
41897044 |
T |
 |
| Q |
200 |
taaatatcaataatattgtcacgggaaaactcaacaaattagt--tatcacttttatagctaggtt |
263 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41897043 |
taagtatcaataatattgtcacgggaaaactcaacaaattagttatatcacttttatagctaggtt |
41896978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 88 - 199
Target Start/End: Original strand, 17333201 - 17333312
Alignment:
| Q |
88 |
acagtggtagtaagtattgatggaaatcctctt-tcacttgttgtagtagcagcagcaaaccgtgcaccatgattttggtactagctagtagctagaacc |
186 |
Q |
| |
|
|||||||||||||| || ||||||||||||| | |||||| |||||||||||||||||||||| ||||||||| ||||||||||||| |||||||| | |
|
|
| T |
17333201 |
acagtggtagtaagaat-gatggaaatcctcctatcactttttgtagtagcagcagcaaaccgagcaccatgaaattggtactagctataagctagaagc |
17333299 |
T |
 |
| Q |
187 |
ccaagaacaatag |
199 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
17333300 |
ccaaaaacaatag |
17333312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University