View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3050_low_20 (Length: 256)
Name: NF3050_low_20
Description: NF3050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3050_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 7 - 245
Target Start/End: Complemental strand, 38995300 - 38995062
Alignment:
| Q |
7 |
gtatatgtttagaggaagcaaatttgttatgtgtcaaagttaaaacgtaagagataaaagaaattaattatgaaagactcatgttcattgaaaattagag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38995300 |
gtatatgtttagaggaagcaaatttgttatgtgtcaaagttaaaacgtaagagataaaagaaattaattatgaaagactcatgttcattgaaaattagag |
38995201 |
T |
 |
| Q |
107 |
gtgtaaatcaaatgcagaggtatgtcttatggcatgaaacaagtttaacaaagctgcaattgttataatagatctcatgccttttagtgtgagattcttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38995200 |
gtgtaaatcaaatgcagaggtatgtcttatggcatgaaacaagtttaacaaagctgcaattgttataatagatctcatgccttttagtgtgagattcttt |
38995101 |
T |
 |
| Q |
207 |
acaatatgtacatgtttcatacaacaaataacacaggtt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38995100 |
acaatatgtacatgtttcatacaacaaataacacaggtt |
38995062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University