View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3050_low_25 (Length: 216)
Name: NF3050_low_25
Description: NF3050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3050_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 9567781 - 9567968
Alignment:
| Q |
17 |
caatttggaagtcaattatgtgaattcttgattcatttttcatttcttcacaaatgacagcattggatgatatataagcaaactgaaaatatgggcaaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9567781 |
caatttggaagtcaattatgtgaattcttgattcattttgcatttcttcacaaatgacagcattggatgatatataagcaaactgaaaatatgggcaaat |
9567880 |
T |
|
| Q |
117 |
ctgatacaaaatgtgcatagcacttatcaactctatgcttgttggttcttcacatttcaaggctttataaattgcactccctgatgat |
204 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9567881 |
ctgatacaaaatgtgcatagcactcatcaactctatgcttgttggttcttcacatttcaaggctttataaattgcactccctgatgat |
9567968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 176
Target Start/End: Original strand, 55913629 - 55913786
Alignment:
| Q |
19 |
atttggaagtcaattatgtgaattcttgattcatttttcatttcttcacaaatgacagcattggatgatatataagcaaactgaaaatatgggcaaatct |
118 |
Q |
| |
|
|||||||| |||||||| ||||| || ||||||||| |||| ||||| |||| |||||||| | ||||| || ||||||| ||||||||| ||||||| |
|
|
| T |
55913629 |
atttggaaatcaattatatgaatcctggattcatttgccattgcttcagaaataacagcatttgcagatatgtatgcaaacttaaaatatggacaaatct |
55913728 |
T |
|
| Q |
119 |
gatacaaaatgtgcatagcacttatcaactctatgcttgttggttcttcacatttcaa |
176 |
Q |
| |
|
|||||| |||||||| | | || | |||| |||| ||||||| |||||||||||| |
|
|
| T |
55913729 |
gatacagcatgtgcatgtaagtcattagctctttgctcgttggttgttcacatttcaa |
55913786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University