View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3050_low_26 (Length: 213)
Name: NF3050_low_26
Description: NF3050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3050_low_26 |
 |  |
|
| [»] scaffold0320 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 45; Significance: 8e-17; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 110 - 182
Target Start/End: Complemental strand, 28122509 - 28122437
Alignment:
| Q |
110 |
caatattctaattgaaccattgatcaagtttttgattcccctgtagcttcttggtcttatggatacagcttga |
182 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||| |||||| |||||||||||||| |||| |||| ||||| |
|
|
| T |
28122509 |
caatatcctaagtgaaccattgatcaagtttttgactcccctatagcttcttggtctaatggctacaacttga |
28122437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 28129018 - 28128970
Alignment:
| Q |
16 |
accaacgtgtgtgacgtagaggctgaaacaaatgactttacattgtaac |
64 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28129018 |
accaacgtgtgtgacgaagaggctgaaacaaatgactttacattgtaac |
28128970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 106 - 139
Target Start/End: Complemental strand, 28177177 - 28177144
Alignment:
| Q |
106 |
caaccaatattctaattgaaccattgatcaagtt |
139 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
28177177 |
caaccaatatcctaattgaaccattgatcaagtt |
28177144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 112 - 185
Target Start/End: Complemental strand, 34816385 - 34816312
Alignment:
| Q |
112 |
atattctaattgaaccattgatcaagtttttgattcccctgtagcttcttggtcttatggatacagcttgattt |
185 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| ||||||||| || ||||| |||||| ||||||||||||| |
|
|
| T |
34816385 |
atatcctaattgaactattgatcaagtttttgactcccctgtatctgattggtattatggctacagcttgattt |
34816312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0320 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0320
Description:
Target: scaffold0320; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 110 - 151
Target Start/End: Complemental strand, 17670 - 17629
Alignment:
| Q |
110 |
caatattctaattgaaccattgatcaagtttttgattcccct |
151 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
17670 |
caatatcctaagtgaaccattgatcaagtttttgactcccct |
17629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University