View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3050_low_27 (Length: 209)
Name: NF3050_low_27
Description: NF3050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3050_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 31897437 - 31897257
Alignment:
| Q |
15 |
cagagaagatcattaacattgcatatatgttcaatacacccgagggtaatgtgttttctttttt-agttccttggtattggcaatgacttagaatcgcat |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||| ||||||||||||||||||||||| |||| |
|
|
| T |
31897437 |
cagagaagatcattaacattgcatacatgttcaatacacccgagggtaatgtgtttcctttttttagttccatggtattggcaatgacttagaattgcat |
31897338 |
T |
 |
| Q |
114 |
ttggggatacaaatattctttacgacttcggttgcaaaatataattagaagtgaggtaataaa-gttgatgtatttagatc |
193 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||| |||||| |||||||||| |
|
|
| T |
31897337 |
ttggggatacaaatattctttaggacttcggttgcaaaatataattataagtgaggtaaaaaaggttgatatatttagatc |
31897257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University