View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3050_low_29 (Length: 203)
Name: NF3050_low_29
Description: NF3050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3050_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 46 - 180
Target Start/End: Original strand, 20086303 - 20086439
Alignment:
| Q |
46 |
agaagagagaaataaatgagatgatgaaagctaatgaagccggtttctatgcatattcatttccatttaatactatcttta--tnnnnnnnnnnnnnnat |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
20086303 |
agaagagagaaataaatgagatgatgaaagctaatgaagccggtttctatgcatattcatttccatttaatactatctttattttctctctctctctcat |
20086402 |
T |
 |
| Q |
144 |
cttcttataataatgtgaattttattttatattaggc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20086403 |
cttcttataataatgtgaattttattttatattaggc |
20086439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University