View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3051_low_15 (Length: 241)
Name: NF3051_low_15
Description: NF3051
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3051_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 27 - 223
Target Start/End: Original strand, 49322527 - 49322722
Alignment:
| Q |
27 |
aaacggtctagtacgaacgtttgacaaaaacaatggaataaagtttgattttggtgcgtttgttggcaaaaaatcgtctttcatatttcaatctaagatg |
126 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
49322527 |
aaacggtctagtacgattgtttgacaaaa-caatggaataaagtttgattttggtgcgtttgttgtcaaaaaatggtctttcatatttcaatctaagatg |
49322625 |
T |
|
| Q |
127 |
tgaccatagagtgtatggattatacaaggatgttgacctcgttatctagtgcaatacgagcgttgatgttgcatgcgacgtgtaaattatacgaaac |
223 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49322626 |
tgagcatagagtgtatggattatacaaggatgttgacctcgttatctagtgcaatacgagcgttgatgttgcatgcgacgtgtaaattatacgaaac |
49322722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University