View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3052_high_25 (Length: 231)
Name: NF3052_high_25
Description: NF3052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3052_high_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 13115305 - 13115108
Alignment:
| Q |
19 |
gtttgcggatttgttttatgttcttcatatggttatgaagtttcggacggcttttgttgctcctaattcgaggattgttggtcgcggtgaccttgttatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13115305 |
gtttgcggatttgttttatgttcttcatatggttatgaagtttcggacggcttttgttgctcctaattcgaggattattggtcgcggtgaccttgttatg |
13115206 |
T |
|
| Q |
119 |
gatccttatcagatcgctatgcggtatttgaagtctgattttgttattgatcttgctgctaccattccattgccccaggtatgtaccatacacctttg |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13115205 |
gatccttatcagattgctatgcggtatttgaagtctgattttgttattgatcttgctgctaccattccattgccccaggtatgtaccatacacctttg |
13115108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University