View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3052_high_27 (Length: 212)
Name: NF3052_high_27
Description: NF3052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3052_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 4 - 195
Target Start/End: Complemental strand, 49696382 - 49696190
Alignment:
| Q |
4 |
atgagcttgtacacatatacatgttttaggtcgtcagcggtcactgtgctctgaaacatgtgattttagttcttatatcatataagtttttgttatcatc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49696382 |
atgagcttgtacacatatacatgttttaggtcgtcagcggtcactgtgatctgaaacatatgattttagttcttatatcatataagtttttgttatcatc |
49696283 |
T |
 |
| Q |
104 |
tgcttgcatgctgtgagc-ttttacacatacatattttgttcttgtctgcatgtttttggttgtcagcggtcattgtgatctgaaacctgtaa |
195 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49696282 |
tgcttgcatgctgtgagctttttacacatacatattttgttcttgtctgcatgtttttggttgtcagcggtcattgtgatctgaaacctgtaa |
49696190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 77
Target Start/End: Complemental strand, 49696233 - 49696179
Alignment:
| Q |
23 |
catgttttaggtcgtcagcggtcactgtgctctgaaacatgtgattttagttctt |
77 |
Q |
| |
|
|||||||| ||| ||||||||||| |||| |||||||| ||| |||||||||||| |
|
|
| T |
49696233 |
catgtttttggttgtcagcggtcattgtgatctgaaacctgtaattttagttctt |
49696179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University