View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3052_high_29 (Length: 201)
Name: NF3052_high_29
Description: NF3052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3052_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 13 - 183
Target Start/End: Original strand, 44236238 - 44236408
Alignment:
| Q |
13 |
cagagacaaaaggctaaggaattgcaggaatatttcaaaaagaagaagcttgaacaagctgcagatcaaggtcccttttttggattcattgccaaaaatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44236238 |
cagagacaaaaggctaaggaattgcaggaatatttcaaaaagaagaagcttgaacaagctgcagatcaaggtcccttttttggattcattgccaaaaatg |
44236337 |
T |
 |
| Q |
113 |
agattagcaatggaaggtaaaaacaaattctttatattattcaattggggttaatttaagttggagtctct |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44236338 |
agattagcaatggaaggtaaaaacaaattctttatattattcaattggggttaatttaagttggagtctct |
44236408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University