View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3052_low_16 (Length: 326)
Name: NF3052_low_16
Description: NF3052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3052_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 88 - 312
Target Start/End: Original strand, 46881989 - 46882218
Alignment:
| Q |
88 |
aaattcttttgtttaacaccttaaaaaatgtgacctttattagtagtatatgtgggttagatttctgaggttgttgttgtt---------actgttggtt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
46881989 |
aaattcttttgtttaacaccttaaaaaatgtgacctttattagtagtatatgtgggttagatttctcaggttgttgttgttgttgttgttactgttggtt |
46882088 |
T |
 |
| Q |
179 |
atgtagctaatttcttttgtatgtgaatttcaacataaataaatgttgtttcttcaataatgggtttggtctatatattgatggcaatgtctattttcac |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46882089 |
atgtagctaatttcttttgtatgtgaatttcaacataa----atgttgtttcttcaataatgggtttggtccatatattgatggcaatgtctattttcac |
46882184 |
T |
 |
| Q |
279 |
aattagttttaccttgtttctaaatgcagggttt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46882185 |
aattagttttaccttgtttctaaatgcagggttt |
46882218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University