View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3052_low_22 (Length: 295)
Name: NF3052_low_22
Description: NF3052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3052_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 19 - 284
Target Start/End: Complemental strand, 37076177 - 37075912
Alignment:
| Q |
19 |
agtttaggcttcttttgaaagttatatctgtgctatgatggcaacctgtaagtatttgttaaaatgattttttagcaggtatcatctaaataattcatgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37076177 |
agtttaggcttcttttgaaagttatatctgtgctatgatggcaaccagtaagtatttgttaaaatgattttttagcaggtatcatctaaataattcatgg |
37076078 |
T |
|
| Q |
119 |
acaaaaattgtttgaaaaaattatcattatattgtttaacattctaaaatatttcctaatttcttgacttgtgagtttatttgggaaaatgaatgtttgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37076077 |
acaaaaattgtttgaaaaaattatcattatattgtttaacattctaaaatatttcctaatttcttgacttgtgagtttatttgggaaaatgaatgtttgg |
37075978 |
T |
|
| Q |
219 |
cgtttttcagacatcgaaatgttacaaagacagataagagacatggttttgacattgcacaggttc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
37075977 |
cgtttttcagacatcgaaatgttacaaagacagataagagacatggttttaacattgcacaagttc |
37075912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University