View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3052_low_28 (Length: 239)
Name: NF3052_low_28
Description: NF3052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3052_low_28 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 107 - 239
Target Start/End: Complemental strand, 657232 - 657100
Alignment:
| Q |
107 |
cgtgaagaagtcaactatttcttttgttagcttcttttagtttgtgactggttttttattcaaaactttgtggaataagtgccggctatttatgttatta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
657232 |
cgtgaagaagtcaactatttcttttgttagcttcttttagtttgtgactggttttttattcaaaactttgtggaataagtgccggctatttatgttatta |
657133 |
T |
|
| Q |
207 |
ttattgcttcgatccaattaagctaagctcaca |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
657132 |
ttattgcttcgatccaattaagctaagctcaca |
657100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 17 - 81
Target Start/End: Complemental strand, 657317 - 657253
Alignment:
| Q |
17 |
catctggtttgcttcttgacataagattctggaaacaaagaggaaatgagattttgattatgttg |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
657317 |
catctggtttgcttcttgacataagattctggaaacaaagaggaaatgagattttgattatgttg |
657253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University