View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3053_low_11 (Length: 240)
Name: NF3053_low_11
Description: NF3053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3053_low_11 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 111 - 240
Target Start/End: Complemental strand, 48272350 - 48272221
Alignment:
| Q |
111 |
tgaaccaatagctacttttaggaaactgaattcctcctatttctggatggtgtagatttaacttcttcagggttaacagaaccaatactctcagatgaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48272350 |
tgaaccaatagctacttttaggaaactgaattcctcctatttctggatggtgtagatttaacttcttcagggttaacagaaccaatactctcagatgaat |
48272251 |
T |
 |
| Q |
211 |
ctgagccactattttcaccatgtcctccct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48272250 |
ctgagccactattttcaccatgtcctccct |
48272221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 48272442 - 48272395
Alignment:
| Q |
18 |
agataaaccactagttttgaggtcctctggacataaagaaactaaccc |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48272442 |
agataaaccactagttttgaggtcctctggacataaagaaactaaccc |
48272395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University