View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3053_low_8 (Length: 247)

Name: NF3053_low_8
Description: NF3053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3053_low_8
NF3053_low_8
[»] chr1 (1 HSPs)
chr1 (1-242)||(48271782-48272023)


Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 48272023 - 48271782
Alignment:
1 tccggattagttgttcccgaccttgagctaccgttggatccaatgctcaagtctttgattcctttagctatgtctggagtgctagtacccgatgacgcag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
48272023 tccggattagttgttcccgaccttgagctaccgttggatccaatgctcaagtctttgattcctttagctatgtctggagtgctagtacccgatgacgcgg 48271924  T
101 cggttctgacctgctcgaaatgtagtacctgcacaattacacgtgtcggtagcctctcgttttgcactgcatgcaaggatgcatcaactgacagctttct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48271923 cggttctgacctgctcgaaatgtagtacctgcacaattacacgtgtcggtagcctctcgttttgcactgcatgcaaggatgcatcaactgacagctttct 48271824  T
201 gcaatccattagctggcatatactcttcttttcacctttgct 242  Q
    ||||||||||||||||||||||||||||||||||||||||||    
48271823 gcaatccattagctggcatatactcttcttttcacctttgct 48271782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University