View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3053_low_9 (Length: 244)

Name: NF3053_low_9
Description: NF3053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3053_low_9
NF3053_low_9
[»] chr3 (1 HSPs)
chr3 (162-234)||(3609887-3609959)


Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 162 - 234
Target Start/End: Original strand, 3609887 - 3609959
Alignment:
162 ataactagttgaaaatcttgattctccaatattgctcctcattctcaacattttggtcctcctgtattctgtg 234  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||    
3609887 ataactagttgaaaatcttgattctccaatattgctcctcattttcaacattttggtcctcctctattctgtg 3609959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University