View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_high_26 (Length: 369)
Name: NF3055_high_26
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 13 - 354
Target Start/End: Original strand, 32052988 - 32053329
Alignment:
| Q |
13 |
aatatcaacaacaacattcgcagtattcggcaactcaaccggtccaggctcaagactaatcttactagattcaaaaaccccgagactctgaagcctagca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32052988 |
aatatcaacaacaacattcgcagtattcggcaactcaaccggtccaggctcaagactaatcttactagattcaaaaaccccgagactctgaagcctagca |
32053087 |
T |
|
| Q |
113 |
agcacaatctccgatgcacgaataagctcctgcatggtggtaacatcttcgattcccttgagttcagcttcgatcacccaatctttggttttcgtgttgc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32053088 |
agcacaatctccgatgcacgaataagctcctgcatggtggtaacatcttcgattcccttgagttcagcttcgatcacccaatctttggttttcgtgttgc |
32053187 |
T |
|
| Q |
213 |
cgcgaattatcacgtcgtggactcggattggaactagctccgatgagaggcgtcgggatagggtttcgagtttgaatttttggtcgcggagacgggagag |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32053188 |
cgcgaattatcacgtcgtggactcggattggaactagctccgatgagaggcgtcgggatagggtttcgagtttgaatttttggtcgcggagacgggagag |
32053287 |
T |
|
| Q |
313 |
tggggattgtggaacatcgtcttcgtcatcttcttcttcttc |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32053288 |
tggggattgtggaacatcgtcttcgtcatcttcttcttcttc |
32053329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 161 - 247
Target Start/End: Original strand, 35835148 - 35835234
Alignment:
| Q |
161 |
tcgattcccttgagttcagcttcgatcacccaatctttggttttcgtgttgccgcgaattatcacgtcgtggactcggattggaact |
247 |
Q |
| |
|
|||||||| | ||||||||||||||| | ||||||||||||||| ||||| ||| || | || ||||||||||| ||||||||| |
|
|
| T |
35835148 |
tcgattccatcgagttcagcttcgattatccaatctttggttttggtgtttccggttatgaaaacatcgtggactcgaattggaact |
35835234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University