View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_high_37 (Length: 325)
Name: NF3055_high_37
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_high_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 8898254 - 8898099
Alignment:
| Q |
1 |
caaatgcttctgccttttctcggtgagtgttcgccattttcttttcacagttttagttctaagttgatatgaaaacacaaaacctaggtgcagtatccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8898254 |
caaatgcttctgccttttctcggtgagtgttcgccgttttcttttcacagttttagctctaaaatgatatgaaaacacaaaacctaggtgcagtatccat |
8898155 |
T |
|
| Q |
101 |
tatttgatctcaactatcaagaaaacaaatgaatcaaaaaatggaagtttgtcata |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
8898154 |
tatttgatctcaactatcaagaaaacaaatgagtcgaaaaatggaagcttgtcata |
8898099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 196 - 309
Target Start/End: Complemental strand, 8898077 - 8897962
Alignment:
| Q |
196 |
tcgctcctagtcttctatatctaggtaaaagctgattacaaagtgatttggtctaaaagataattgtgagagcttcaatatgg--tttattagagcaacc |
293 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8898077 |
tcgctcctagtcttctatatctaggcaaaagctgattacgaagtgatttggtctaaaagataattgtgagagcttcaatatggtttttattagagcaacc |
8897978 |
T |
|
| Q |
294 |
taattatggtaaatat |
309 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8897977 |
taattatggtaaatat |
8897962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University