View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_high_45 (Length: 274)
Name: NF3055_high_45
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 9e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 16 - 168
Target Start/End: Complemental strand, 24353050 - 24352898
Alignment:
| Q |
16 |
cacttcttagtacttcaattcaagaaaaataattggtggtggtggtagttgtgcttaactcttgagttgaaaaatagtgtgataatgagttaaagggttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24353050 |
cacttcttagtacttcaattcaagaaaaataattggtggtggtggtagttgtgcttaactcttgagttgaaaaatagtgtgataatgagttaaagggttt |
24352951 |
T |
 |
| Q |
116 |
gataattgatcctcccctcgatgtaatagtaattatactaagtactaagattt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24352950 |
gataattgatcctcccctcgatgtaatagtaattgtactaagtactaagattt |
24352898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 154 - 218
Target Start/End: Complemental strand, 24352872 - 24352808
Alignment:
| Q |
154 |
taagtactaagatttgttgtttgaataaatatcctttggtcattgactataaccattcattgaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24352872 |
taagtactaagatttgttgtttgaataaatattctttggtcattgactataaccattcattgaaa |
24352808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University