View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_high_48 (Length: 267)
Name: NF3055_high_48
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_high_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 40879865 - 40879689
Alignment:
| Q |
16 |
atgaaggagttgtgatgcatgaagagataggtgaagcagaagttgttgctttaatttcaataaatcttctatgttggaacaagtttattgtttttagaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40879865 |
atgaaggagttgtgatgcatgaagagataggtgaagcaaaagttgtcgc-----tttcaataaatcttctatgttggaacaagtttattgtttttagaat |
40879771 |
T |
 |
| Q |
116 |
aagaagaagtattaaagagaaaggagagaattcacttttggattgaaaggatcaagtttattcattccaatatattgtgaga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40879770 |
aagaagaagtattaaagagaaaggagagaattcacttttggattgaaaggatcaagtttattcattccaatatattgtgaga |
40879689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 193 - 248
Target Start/End: Complemental strand, 40879635 - 40879580
Alignment:
| Q |
193 |
tgagaagtgtgataaaattactccaagaggccaccaaattgtgaaagaggtgaaac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40879635 |
tgagaagtgtgataaaattactccaagaggccaccaaattgtgaaagaggtgaaac |
40879580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University