View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_high_59 (Length: 233)
Name: NF3055_high_59
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_high_59 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 6544899 - 6544678
Alignment:
| Q |
1 |
aaattgtgatggtcgggtcaatcatatttgattgtgtttctccgcattatcttggaatataaccgtggctgcgatttaaaaccttgtttctatccttgtt |
100 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6544899 |
aaattgtgatggtcgcgtcaatcgtatttgattgtgattctccgcattatcttggaatataaccatggctgcgatttaaaaccttgtttctatccttgtt |
6544800 |
T |
|
| Q |
101 |
cccttctcttgaatgtatccatccttcttagttgattatttaacaaatgtttacacaaatttttgttgatgatctcgtctgcatggttatatttcgaatc |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
6544799 |
cccttctcttgaatgtattcatccttcttatttaattatttaacaaatgtttacacaactttttgttgatgatcttgtctgcatggttatatttcaaatc |
6544700 |
T |
|
| Q |
201 |
aaacttagtgaatgtttggttt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6544699 |
aaacttagtgaatgtttggttt |
6544678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University