View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_high_62 (Length: 209)
Name: NF3055_high_62
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_high_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 8087279 - 8087105
Alignment:
| Q |
15 |
cacagacacttccatctcatcattatttttatttttctctgccttaccagctgaacaaaccgatcccatttttgtnnnnnnnnttcaaaacctgcacaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
8087279 |
cacagacacttccatctcatcattatttttatttttctctgccttaccagctgaacaaaccgatcccatttt-gtaaaaaaa-ttcaaaacctgcacaaa |
8087182 |
T |
 |
| Q |
115 |
ttcgtataatatatattatagagtaactttataacaattttaagtctaagaaga-aaaataaagaccaactgaattt |
190 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8087181 |
ttcgtataatatatactatagagtaactttataacaattttaagtctaagaagaaaaaataaagaccaactgaattt |
8087105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University