View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_low_14 (Length: 500)
Name: NF3055_low_14
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 1e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 21602398 - 21602579
Alignment:
| Q |
18 |
acttccgatgctgagcaaaatagattattgattccatggcatatgaccgaataattgatatgattgcaaacctaaccctatgtctaggcagtatctacac |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
21602398 |
acttccgttgctgagcaaaatagattattgattccatggcatatgaccggataattaatatgattgcaaacctaaccctatgtttaggcagtatctagac |
21602497 |
T |
|
| Q |
118 |
atgatttaaaatagatcctttagataaaaatcttatgcctctcactttctaaatcaaataattattttcggagtgcacgtcg |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21602498 |
atgatttaaaatagatcatttagataaaaatcttatatctctcactttctaaatcaaataattattttcgaagtgcacgtcg |
21602579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 199
Target Start/End: Complemental strand, 1819295 - 1819203
Alignment:
| Q |
107 |
agtatctacacatgatttaaaatagatcctttagataaaaatcttatgcctctcactttctaaatcaaataattattttcggagtgcacgtcg |
199 |
Q |
| |
|
|||||||||||||| |||||| | |||| ||||||||| || | ||| || |||||||||||||||||||| ||||| ||| ||||||||| |
|
|
| T |
1819295 |
agtatctacacatggcttaaaacatatcccttagataaacatatgatgtttcacactttctaaatcaaataatcatttttggattgcacgtcg |
1819203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 2558891 - 2558809
Alignment:
| Q |
18 |
acttccgatgctgagcaaaatagattattgattccatggcatatgaccgaataattg-atatgattgcaaacctaaccctatg |
99 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||| ||| ||||| |||||||| ||| |||| | |||||||| |||||||| |
|
|
| T |
2558891 |
acttccgatgttgagcaaaatagacaattgattcaatgacatataaccgaatagttgaatataaatgcaaaccagaccctatg |
2558809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 442547 - 442616
Alignment:
| Q |
30 |
gagcaaaatagattattgattccatggcatatgaccgaataattg-atatgattgcaaacctaaccctat |
98 |
Q |
| |
|
||||||||||| | |||||||| ||| | |||||||||||| ||| |||||| || |||||||||||||| |
|
|
| T |
442547 |
gagcaaaatagttgattgattcgatgtcgtatgaccgaatagttgaatatgaatgtaaacctaaccctat |
442616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University