View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_low_32 (Length: 351)
Name: NF3055_low_32
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 18 - 171
Target Start/End: Complemental strand, 37277106 - 37276953
Alignment:
| Q |
18 |
taaccgaccataatatgtgacgtgtaagtataaatcttatgtcaccattttcattttatattcgtaaaaaacatatagaccaaacnnnnnnnnnncaata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37277106 |
taaccgaccataatatgtgacgtgtaagtataaatcttatgtcaccattttcattttatattcgtaaaaaacatatagaccaaacaaaaaaaaaacaata |
37277007 |
T |
|
| Q |
118 |
gtattatacatacgtttaaaagatttggattgtgttaaaatttgaatctcaata |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37277006 |
gtattatacatacgtttaaaagatttggattgtgttaaaatttgaatctcaata |
37276953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 223 - 254
Target Start/End: Complemental strand, 37276953 - 37276922
Alignment:
| Q |
223 |
attgcggtggatctaaaatctcgttttttctt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37276953 |
attgcggtggatctaaaatctcgttttttctt |
37276922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University