View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_low_40 (Length: 325)
Name: NF3055_low_40
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 37959240 - 37959069
Alignment:
| Q |
15 |
cagagaaatagttatcaagaagattttgtgaagcatcagcaacgatattccaaggacaaaatagatgcgtggaaagctgccttattccaggttgctgggc |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
37959240 |
cagagaaatagttatcaagaagattttatgaagcatcagcaacgat---ccaaggacaaaatagatgcatggaaagctgccctattccaggttgctgggc |
37959144 |
T |
 |
| Q |
115 |
tctcaggcttgcattcacaaaatatcaggtcactaatttatttacacgttcttgccattattcctcaactttttc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37959143 |
tctcaggcttgcattcacaaaatatcaggtcactaatttatttacacgttcttgccattattcctcaactttttc |
37959069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 184 - 307
Target Start/End: Complemental strand, 37959032 - 37958909
Alignment:
| Q |
184 |
tttttcggacagcaacgtagtaatttcttgatcaggcaacttaaaaaatatatatattttaatttttactttctagctaattaaaaaatactgagcataa |
283 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37959032 |
tttttcggacagccacgtagtaatttcttgatcaggcaacttaaaaaatatatattttttaatttttactttctagctaattaaaaaatactgagcataa |
37958933 |
T |
 |
| Q |
284 |
atctcgattgtctgatcttaatca |
307 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37958932 |
atctcgattgtctgatcttaatca |
37958909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University