View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3055_low_41 (Length: 310)

Name: NF3055_low_41
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3055_low_41
NF3055_low_41
[»] chr5 (2 HSPs)
chr5 (229-296)||(28742129-28742196)
chr5 (61-125)||(28742200-28742264)


Alignment Details
Target: chr5 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 229 - 296
Target Start/End: Complemental strand, 28742196 - 28742129
Alignment:
229 tcgaaggatagggttcgtcttggaaggtgttgctgcttccgtgtgttggttgttttttcttgcctttg 296  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
28742196 tcgaaggatagggttcgtcttggaaggtgttgctgcttacgtgtgttggttgttttttcttgcctttg 28742129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 61 - 125
Target Start/End: Complemental strand, 28742264 - 28742200
Alignment:
61 tacatattgtctatgcgcggtgttagtggcggcttgttggtgtgctgctagatcatgttctgaat 125  Q
    ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||    
28742264 tacatattgtctatgagcggtgttagtggcggcttgttggtgtgttgctagatcatgttctgaat 28742200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University