View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_low_46 (Length: 276)
Name: NF3055_low_46
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 9 - 268
Target Start/End: Original strand, 33401572 - 33401831
Alignment:
| Q |
9 |
aaaccgccagtctgaaaatttttaggataaacatcagacccaaatttggccttttggtcacttttccatgctatattctttttgttaatcaccaagtcct |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33401572 |
aaactgccagtctgaaaatttttaggataaacatcagacccaaatttggccttttggtcacttttccatgctatattctttttgttaatcaccaagtcct |
33401671 |
T |
|
| Q |
109 |
tattattgtttgaaaatctgtatgtgtcattgaatagactccatgcagcaaggccgcaaggaacaaccggaagataaccatttgcagtatagtcttcagg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33401672 |
tattattgtttgaaaatctgtatgtgtcattgaatagactccaagcagcaaggccacaaggaacaaccggaagataaccatttgcagtatagtcttcagg |
33401771 |
T |
|
| Q |
209 |
aaagcatttgcctacatcattctcatctgccttactcctcaattgtttatgatctctgct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33401772 |
aaagcatttgcctacatcattctcatctgccttactcctcaattgtttatgatctctgct |
33401831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 9 - 174
Target Start/End: Complemental strand, 43599575 - 43599410
Alignment:
| Q |
9 |
aaaccgccagtctgaaaatttttaggataaacatcagacccaaatttggccttttggtcacttttccatgctatattctttttgttaatcaccaagtcct |
108 |
Q |
| |
|
||||| ||| |||||||||||||||||||||| ||| |||||||| | |||| ||||||| ||||||||| ||||||||||| || || |||| |
|
|
| T |
43599575 |
aaacctccactctgaaaatttttaggataaacttcatgaccaaatttagaatttttgtcacttccccatgctatgttctttttgttgatagttaaatcct |
43599476 |
T |
|
| Q |
109 |
tattattgtttgaaaatctgtatgtgtcattgaatagactccatgcagcaaggccgcaaggaacaa |
174 |
Q |
| |
|
| || | |||||||| |||| ||||||||||| | |||||||||| ||||| |||||||||| |
|
|
| T |
43599475 |
tgttgtcaattgaaaatttgtaggtgtcattgaacatactccatgcaatgaggccacaaggaacaa |
43599410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University