View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_low_5 (Length: 781)
Name: NF3055_low_5
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 2e-94; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 2e-94
Query Start/End: Original strand, 555 - 765
Target Start/End: Original strand, 14135224 - 14135435
Alignment:
| Q |
555 |
ttccttcaaaatgatatttggtacaaattctttagcttgggcaccaatgcttggttctcatggaatctctcaaattactctgatacttatctttggcatt |
654 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14135224 |
ttccttaaaaatgatatttggtacaaattctttagcttgggcaccaatgcttggttctcatggaatctctcaaattactctgatacttatctttggcatt |
14135323 |
T |
|
| Q |
655 |
ttcaattgctctcaatgcctaacccttccgtgaaacagcctaagaaatgaacatct-tgttcatgaagatgccctgacatgaagaaagaccaggattacc |
753 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||| |||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
14135324 |
ttcaattgctctcaatgcctaacccttccgtggaacagcctaagaaatgaacatttgtgtttatgaagatgccccgacatgaagaaagatcaggattacc |
14135423 |
T |
|
| Q |
754 |
tatggttgcacc |
765 |
Q |
| |
|
||||| |||||| |
|
|
| T |
14135424 |
tatggatgcacc |
14135435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 486 - 558
Target Start/End: Original strand, 14135079 - 14135151
Alignment:
| Q |
486 |
tctttgtaaaattgctcatgttactcttctcacaaacttcaaaagacaaaaccgatgtatgtctcaagattcc |
558 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14135079 |
tctttgtaaaattgctcatgttactcttctcacaaacttcaaaagacataaccgatgtatgtctcaagattcc |
14135151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 49 - 108
Target Start/End: Original strand, 14135022 - 14135081
Alignment:
| Q |
49 |
aatttgaaaattcttaatcaaacatatattcataagttggcttgccaactaactccttct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14135022 |
aatttgaaaattcttaatcaaacatatattcataagttggcttgccaactaactccttct |
14135081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 12 - 63
Target Start/End: Original strand, 14134953 - 14135004
Alignment:
| Q |
12 |
atgaaacccaaaggaagagggtggtcttggttttcgtaatttgaaaattctt |
63 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14134953 |
atgaaacccaaagggagagggtggtcttggttttcgtaatttgaaaattctt |
14135004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University