View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_low_50 (Length: 268)
Name: NF3055_low_50
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_low_50 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 9 - 268
Target Start/End: Complemental strand, 8898516 - 8898257
Alignment:
| Q |
9 |
agcagagagaaccctgatattgataccgagatatgtgcatgtagtaatgaactgatagaaccttctagtagagctgtcgacttgatttccacatttggga |
108 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8898516 |
agcagagagaaccccgatattgataccgagatacgtgaatgtagtaatgaactgatagaaccttctagcagagctgtcgacttgatttccacatttggga |
8898417 |
T |
 |
| Q |
109 |
atctccataagcgcactaaggaaatccatgttactaatggggataaagaaaccaagtttgattttgaaaaagaactggagctttctttaagaagtgattt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8898416 |
atctccataagcgcactaaggaaatccatgttactaatggggataaagaaaccaagtttgattttgaaaaagaactggagctttctttaagaagtgattt |
8898317 |
T |
 |
| Q |
209 |
ttctggcagctcatgcaaacaagcaagtgaaacaactgaggagtggcaaagattgaacca |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8898316 |
ttctggcagctcatgcaaacaagcaagtgaaacaactgaggagtggcaaagattgaacca |
8898257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University