View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_low_57 (Length: 250)
Name: NF3055_low_57
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_low_57 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 1412867 - 1413066
Alignment:
| Q |
18 |
agatgttgcagtaccaaagcaactaactttcacatcaacgagtttaaggatcttgaaagtttcacatccgatttaaacctcacatacatggatgaaacta |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1412867 |
agatgttacagtaccaaagcaactaactttcacatcaacgagtttaaggatcttgaaagttccacatccgatttaaacctcacatacatggatgaaacta |
1412966 |
T |
|
| Q |
118 |
tgaagtagtaaggggaagtggagaatcaagagttgccaatgccattgaaatatgacaataggaagacatttattttttgtaaagaaatgtaaagacatga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1412967 |
tgaagtagtaaggggaagtggagaatcaagagttgccaatgcca-tgaaatatgacaataggaagacacttattttttgtaaagaaatgtaaagacatga |
1413065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University