View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_low_64 (Length: 234)
Name: NF3055_low_64
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_low_64 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 67 - 222
Target Start/End: Complemental strand, 15621773 - 15621614
Alignment:
| Q |
67 |
ctttcagactattaaaaacactgt--agaaaaaagttcttgacaacttatagtttacagtgaactaaagttcatattgatatgtagatatggagattcgt |
164 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15621773 |
ctttcagactattaaaaacactgtgtagaaaaaagttgttgacaacttatagtttacagtgaactaaagttcatattgatatgtagatatggagattcgt |
15621674 |
T |
|
| Q |
165 |
cctaaggaaagggaaggtactataatgtacaaatcatgagagaga--gactattatattt |
222 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15621673 |
cctaaggaaagggaaggtaccataatgtacaaatcatgagagagagggactattatattt |
15621614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University