View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3055_low_69 (Length: 204)
Name: NF3055_low_69
Description: NF3055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3055_low_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 14 - 183
Target Start/End: Complemental strand, 43654811 - 43654640
Alignment:
| Q |
14 |
cagagagcaaacaatggatgcttaaagagcaattttcatcaaattttgcacccgaaaagatgggatagtaattaaggtggaagttattattttaccc-nn |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43654811 |
cagagagcaaacaatggatgcttaaagagcaattttcatcaaatttcgcacccgaaaagatgggatagtaattaagatggaagttattattttacccaaa |
43654712 |
T |
|
| Q |
113 |
nnnnnntagaacgaattatattttttatgag-nnnnnnnntgaagcaatcacttcttggtatgatgagcaat |
183 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43654711 |
aaaaaatagaatgaattatattttttatgagcaaaaaaaatgaagcaatcacttcttggtatgatgagcaat |
43654640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University