View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3056-3-Insertion-20 (Length: 153)
Name: NF3056-3-Insertion-20
Description: NF3056-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3056-3-Insertion-20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 4e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 4e-27
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 9391592 - 9391653
Alignment:
| Q |
8 |
gaaataaccctaagctctatataaatgatatttttcacttccttaattcatttccatgaatc |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9391592 |
gaaataaccctaagctctatataaatgatatttttcacttccttaattcatttccatgaatc |
9391653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 110 - 153
Target Start/End: Original strand, 9391742 - 9391785
Alignment:
| Q |
110 |
ttgcacttttgcaatacttaatatgtgttaggattttgtcttga |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9391742 |
ttgcacttttgcaatacttaatatgtgttaggattttgtcttga |
9391785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University