View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3056-3-Insertion-20 (Length: 153)

Name: NF3056-3-Insertion-20
Description: NF3056-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3056-3-Insertion-20
NF3056-3-Insertion-20
[»] chr6 (2 HSPs)
chr6 (8-69)||(9391592-9391653)
chr6 (110-153)||(9391742-9391785)


Alignment Details
Target: chr6 (Bit Score: 62; Significance: 4e-27; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 4e-27
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 9391592 - 9391653
Alignment:
8 gaaataaccctaagctctatataaatgatatttttcacttccttaattcatttccatgaatc 69  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9391592 gaaataaccctaagctctatataaatgatatttttcacttccttaattcatttccatgaatc 9391653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 110 - 153
Target Start/End: Original strand, 9391742 - 9391785
Alignment:
110 ttgcacttttgcaatacttaatatgtgttaggattttgtcttga 153  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
9391742 ttgcacttttgcaatacttaatatgtgttaggattttgtcttga 9391785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University