View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3056-3-Insertion-22 (Length: 116)

Name: NF3056-3-Insertion-22
Description: NF3056-3
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3056-3-Insertion-22
NF3056-3-Insertion-22
[»] chr1 (4 HSPs)
chr1 (8-115)||(1840570-1840677)
chr1 (14-108)||(1866506-1866600)
chr1 (14-108)||(1832347-1832443)
chr1 (22-101)||(9157703-9157782)


Alignment Details
Target: chr1 (Bit Score: 108; Significance: 1e-54; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 115
Target Start/End: Original strand, 1840570 - 1840677
Alignment:
8 tcaattactatgggtgcaagaacaatagctattgtgatgacaaggataaagattttggttaccgatgcatttgtaatcaaggttttgaaggaaatcctta 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1840570 tcaattactatgggtgcaagaacaatagctattgtgatgacaaggataaagattttggttaccgatgcatttgtaatcaaggttttgaaggaaatcctta 1840669  T
108 tgaaccca 115  Q
    ||||||||    
1840670 tgaaccca 1840677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 63; E-Value: 7e-28
Query Start/End: Original strand, 14 - 108
Target Start/End: Original strand, 1866506 - 1866600
Alignment:
14 actatgggtgcaagaacaatagctattgtgatgacaaggataaagattttggttaccgatgcatttgtaatcaaggttttgaaggaaatccttat 108  Q
    ||||||||||||||||||||||  |||||||||||||||| | | |||||||||||||||||  ||| |||||||||||||||||||||||||||    
1866506 actatgggtgcaagaacaatagtcattgtgatgacaaggacacatattttggttaccgatgccattgcaatcaaggttttgaaggaaatccttat 1866600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 58; E-Value: 7e-25
Query Start/End: Original strand, 14 - 108
Target Start/End: Complemental strand, 1832443 - 1832347
Alignment:
14 actatgggtgcaagaacaatagctattgtgatgacaaggataaagattttggttac--cgatgcatttgtaatcaaggttttgaaggaaatccttat 108  Q
    |||||||||||||||| ||||||||||||||||||||||| | | |||||||||||  ||||||  ||| |||||||||||||||||||||||||||    
1832443 actatgggtgcaagaagaatagctattgtgatgacaaggacacatattttggttaccgcgatgccattgcaatcaaggttttgaaggaaatccttat 1832347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 22 - 101
Target Start/End: Complemental strand, 9157782 - 9157703
Alignment:
22 tgcaagaacaatagctattgtgatgacaaggataaagattttggttaccgatgcatttgtaatcaaggttttgaaggaaa 101  Q
    |||||||| |||||  |||||||||| ||||| |  ||||||||||||||||| |  |||||  |||||| |||||||||    
9157782 tgcaagaaaaatagtgattgtgatgataaggacattgattttggttaccgatgtaaatgtaaggaaggttatgaaggaaa 9157703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University