View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3056-Insertion-23 (Length: 450)
Name: NF3056-Insertion-23
Description: NF3056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3056-Insertion-23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 9e-37; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 184 - 266
Target Start/End: Original strand, 32272277 - 32272359
Alignment:
| Q |
184 |
tgaaataattcattccaagggacagctaaatcacagctcaaagcccaccagattctctctctatcgtttttcctaggctcttg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32272277 |
tgaaataattcattccaagggacagctaaatcacagctcaaagcccaccagattctctctctatcttttttcctaggctcttg |
32272359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 8 - 75
Target Start/End: Original strand, 32272103 - 32272170
Alignment:
| Q |
8 |
gatatggtaagattatgagtttgtgagatctaagagaaatggaaatggaaaatgtggttgtttaatgt |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32272103 |
gatatggtaagattatgagtttgtgagatctaagagaaatggaaatggaaaatgtggttgtttaatgt |
32272170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 326 - 370
Target Start/End: Original strand, 32272417 - 32272461
Alignment:
| Q |
326 |
ctaaccattgtttagatatacttcatctccactaaactctctaaa |
370 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32272417 |
ctaaccattgtttagatatacttgatctccactaaactctctaaa |
32272461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 99 - 130
Target Start/End: Original strand, 32272192 - 32272223
Alignment:
| Q |
99 |
tgaggaagatgattttctagggattttggaac |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32272192 |
tgaggaagatgattttctagggattttggaac |
32272223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University