View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3056-Insertion-33 (Length: 230)
Name: NF3056-Insertion-33
Description: NF3056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3056-Insertion-33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 49436263 - 49436139
Alignment:
| Q |
8 |
ttctgactaaccatatcattctctttccaaattttacttcatctttctctctttcgagaagcttctgcttgtgaaggtggagcttctcgtcgtttctcat |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49436263 |
ttctaactaaccatatcattctctttccaaattttacttcatctttctctctttcgagaagcttctgcttgtgaaggtggagcttctcgtcgtttctcat |
49436164 |
T |
 |
| Q |
108 |
cctttcggttacgatcgaatttgtg |
132 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
49436163 |
cctttctgttacgatcgaatttgtg |
49436139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 181 - 230
Target Start/End: Complemental strand, 49436090 - 49436041
Alignment:
| Q |
181 |
tgaataatcgcattcgttttttagcgcgctttattaatttcgtttgtata |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49436090 |
tgaataatcgcattcgttttttagcgcgctttattaatttcgtttgtata |
49436041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University