View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3056-Insertion-39 (Length: 97)
Name: NF3056-Insertion-39
Description: NF3056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3056-Insertion-39 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 7e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 7e-37
Query Start/End: Original strand, 8 - 97
Target Start/End: Original strand, 27222572 - 27222661
Alignment:
| Q |
8 |
agaagttgatctcaataacaaaactcttcaattaaaaagaacttcataatagacatcagaattacttcatattgcatatcagaagatcag |
97 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27222572 |
agaagttgatctcaataacaaaagtcttcaattaaaaagaacttcataacagacatcagaattacttcatattgcatatcagaatatcag |
27222661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 16 - 96
Target Start/End: Complemental strand, 21914995 - 21914915
Alignment:
| Q |
16 |
atctcaataacaaaactcttcaattaaaaagaacttcataatagacatcagaattacttcatattgcatatcagaagatca |
96 |
Q |
| |
|
|||| |||||||||| |||||||| ||||||||||||||| || |||||||| |||||| |||| | |||||||||||| |
|
|
| T |
21914995 |
atcttaataacaaaattcttcaataaaaaagaacttcatattaaacatcagacgcacttcagattgtagatcagaagatca |
21914915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University