View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3056_high_10 (Length: 234)
Name: NF3056_high_10
Description: NF3056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3056_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 66 - 217
Target Start/End: Original strand, 6236142 - 6236293
Alignment:
| Q |
66 |
tttatatcttgggtgtagaatgggtgtttgtgtctacgtagattattttcctaatcaatgtcactatgttttttgatttataagaacgaaatgaagaaga |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6236142 |
tttatatcttgggtgtagaatgggtgtttgtgtctacgtagattattttcctaatcaatgtcactatgttttttgatttataagaacgaaatgaacaaga |
6236241 |
T |
|
| Q |
166 |
aataacacaaaaggtaaacacatccatatctacagggctcactgcatatagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6236242 |
aataacacaaaaggtaaacacatccatatctacagggctcactgcatatagt |
6236293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 106 - 196
Target Start/End: Original strand, 6240344 - 6240435
Alignment:
| Q |
106 |
gattattttcctaatcaatgtcactatgttttttgatttata-agaacgaaatgaagaagaaataacacaaaaggtaaacacatccatatct |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| | || ||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
6240344 |
gattattttcctaatcaacatcactatgttttttgatttatatacaaacaaatgaacatgaaataacacaaaaggtaaacacatccatatct |
6240435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 52
Target Start/End: Original strand, 6236094 - 6236124
Alignment:
| Q |
22 |
atgtatcacaattatcatatcactttctcta |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6236094 |
atgtatcacaattatcatatcactttctcta |
6236124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University