View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3056_high_8 (Length: 242)
Name: NF3056_high_8
Description: NF3056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3056_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 133 - 180
Target Start/End: Complemental strand, 3427760 - 3427713
Alignment:
| Q |
133 |
ttttcttccctcttctatctcactacacacacgcacaacacaaactga |
180 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3427760 |
ttttcttccatcttctatctcactacacacacgcacaacacaaactga |
3427713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 59 - 131
Target Start/End: Complemental strand, 29235475 - 29235403
Alignment:
| Q |
59 |
aaaatgtgcttgcggcgaggaatacaaagttgtattgaataaatagttgcagtgtacttgaacatgcaaactt |
131 |
Q |
| |
|
||||||||| || || |||||||||||||||| |||||||| | || ||||||||||||||||||| |||||| |
|
|
| T |
29235475 |
aaaatgtgcctgtggtgaggaatacaaagttgcattgaatacacagctgcagtgtacttgaacatgaaaactt |
29235403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University